View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3619_low_5 (Length: 339)
Name: NF3619_low_5
Description: NF3619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3619_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 1 - 330
Target Start/End: Complemental strand, 52386254 - 52385925
Alignment:
| Q |
1 |
ccgttatcctttctaacatctccgcagctgactttgcagccatgacgacgaggtttatcaggattgtcaggatcagaatcacttggttccaccagaagtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52386254 |
ccgttatcctttctaacatctccgcagctgactttgcagccatgacgacgaggtttatcaggattgtcaggatcagaatcacttggttccaacagaagtc |
52386155 |
T |
 |
| Q |
101 |
ctctcaggcatcgtcttcgaaccattggttggtaagttaacctctctacccggctaactgttttaacttcagctttgcggttttccaaaccttgtttaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52386154 |
ctctcaggcatcgtcttcgaaccattggttggtaagttaacctctctacccggctaactgttttaacttcagcttcgcggttttccaaaccttgtttaac |
52386055 |
T |
 |
| Q |
201 |
ttgaggctcaggcttttcgggaagaatgacatgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52386054 |
ttgaggctcaggcttttcgggaagaatgacatgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttg |
52385955 |
T |
 |
| Q |
301 |
ctgttcacatatgcctttcccgcttcatct |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52385954 |
ctgttcacatatgcctttcccgcttcatct |
52385925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 232 - 314
Target Start/End: Complemental strand, 7087895 - 7087813
Alignment:
| Q |
232 |
tgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttgctgttcacatatgc |
314 |
Q |
| |
|
||||| || ||||||||| |||| |||||||| || | ||| | ||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
7087895 |
tgaactccagggtctctttcattgattgaaccatgaaacatgagtgaattattgatactttgtatgttgctgttaacatatgc |
7087813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University