View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3619_low_8 (Length: 286)
Name: NF3619_low_8
Description: NF3619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3619_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 16 - 279
Target Start/End: Complemental strand, 2626583 - 2626320
Alignment:
| Q |
16 |
gaaagatttcaaaacttgatgttccaacagtcttttacatgtgaatcatctcctagtttagcatctggcttccattctgataatcttgaggctaatgcca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2626583 |
gaaagatttcaaaacttgatgttccaacagtcttttacatgtgaatcatctcctagtttagcgtctggcttccattctgataatcttgaggctaatgcca |
2626484 |
T |
 |
| Q |
116 |
gtgcaacaaaagtaaaatctgtattaagatctagctcttctgtttaccaggagaggctgcaaagaaattgtgatggtgatataagtataacacctcttat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2626483 |
gtgcaacaaaagtaaaatctgtattaagatctagctcttctgtttaccaggagaggctgcaaagaagttgtgatggtgatataagtataacacctcttaa |
2626384 |
T |
 |
| Q |
216 |
gccaaaagagtcagcaagattaaaatcattttctggagatcattcgccaattatattcatttca |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
2626383 |
gccaaaagagtcagcaagattaaaatcattttctggagatcgttcgccaattatattcagttca |
2626320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University