View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3620_high_10 (Length: 384)
Name: NF3620_high_10
Description: NF3620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3620_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 298; Significance: 1e-167; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 354
Target Start/End: Complemental strand, 26881107 - 26880754
Alignment:
| Q |
1 |
ttggtgagtccacattcctctctgattcctcccataaaataacactcccttttaagtttttatgatattttctcttatgaatagattgataatagagact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26881107 |
ttggtgagtccacattcctctctgattcctcccataaaataacactcccttttaagtttttatgatattttctcttatgaatagatcgataatagagact |
26881008 |
T |
|
| Q |
101 |
cttctgagccaaagattagttccgtgaaagctgtgcaactctgtgatcgtaacttcagtgttggtgctgatggagttatatttgtcttgcctggtatcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
26881007 |
cttctgagccaaagattagttccgagaaagttgtgcaactctgtgatcgtaacttcagtgttggtgcagatgaagttatatttgtcttgcctggtatcaa |
26880908 |
T |
|
| Q |
201 |
tggcactgactatacgatgaggattttcaaccctgatggtagtgagccttaggtgattaattgttcttaaaattatatttgttcaggtacgtgtcgtaat |
300 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||| ||| ||||||||||||| |||| || |
|
|
| T |
26880907 |
tggcactgactatacaatgaggattttcaactctgatggtagtgagcctgaggtgattaattcttcttaaaattgtatgtgttcaggtacgtatcgtgat |
26880808 |
T |
|
| Q |
301 |
tggttcttggtcttcattaactgacaagtttgctttgtttcttacattcatgca |
354 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26880807 |
ttgttcttggtcttcattaactgacaagtttgctttgtttcttacattcatgca |
26880754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 75 - 254
Target Start/End: Complemental strand, 40252643 - 40252464
Alignment:
| Q |
75 |
ttatgaatagattgataatagagactcttctgagccaaagattagttccgtgaaagctgtgcaactctgtgatcgtaacttcagtgttggtgctgatgga |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
40252643 |
ttatgaatagattgataatagagactcttctgagccaaagattagttcagagaaagctgtacaactatgtgatcgtaactttggtgttggtgctgatgga |
40252544 |
T |
|
| Q |
175 |
gttatatttgtcttgcctggtatcaatggcactgactatacgatgaggattttcaaccctgatggtagtgagccttaggt |
254 |
Q |
| |
|
||||| ||||| |||||||||||| |||| ||||| ||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
40252543 |
gttatctttgtattgcctggtatcgatggtactgattatacaatgaggattttcaactctgatggtagtgagcctgaggt |
40252464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University