View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3620_high_6 (Length: 512)
Name: NF3620_high_6
Description: NF3620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3620_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 24 - 408
Target Start/End: Original strand, 12881934 - 12882319
Alignment:
| Q |
24 |
agaaggttgagaacgtcggtggtgatggaatatgcggcgctacagaatatggcgggaattgttgatgggttgtggttgtgggaaaggatgaattgttgca |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12881934 |
agaaggttgagaacgtcggtggtgatggaatatgcggcgctgcagaatatggcgggaattgttgatgggttgtggttgtgggaaaggatgaattgttgca |
12882033 |
T |
 |
| Q |
124 |
gtgataggcctgagggtttggggtttaggaaattgaatttgtgagagtagagtgattcgaaggtggagaaacatgttggtggaccaagaacaagtacttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12882034 |
gtgataggcctgagggtttggggtttaggaaattgaatttgtgagagtagagtgattcgaaggtggagaaacatgttggtggaccaagaacaagtacttt |
12882133 |
T |
 |
| Q |
224 |
tggaagctctttggccattgaattttaaggatttgtggtgtttgagaaagggatgaaattagcactctcatttggatgacactcaaaactgtggctagaa |
323 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
12882134 |
tggaaggtctttggccattgaattttaaggatttgtggtgtttgagaaagggatgaacttagcacttttatttggatgacactcaaaactgtggctagaa |
12882233 |
T |
 |
| Q |
324 |
actcctcttaatta-ttctctgtatcacttgtcttccatgaagcaccaacacgtcttagattagaagtattccggtgtcggataca |
408 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||| | |||| | ||||||||||| ||||| |||||||||||||| |
|
|
| T |
12882234 |
actcctcttaattatttctctgtatcacttgacttccatgaagcgcgaacatgccttagattagacgtatttcggtgtcggataca |
12882319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University