View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3620_low_14 (Length: 320)
Name: NF3620_low_14
Description: NF3620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3620_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 41705931 - 41705632
Alignment:
| Q |
1 |
gagtagctaactgagctgggagagaaagtaatccacgaccgaagccagcgactccggtgggttcggagaaagttgtatgagcacaaccgaatgtgaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41705931 |
gagtagctaactgagctgggagagaaagtaatccacgaccgaagccagcgactccggtgggttcggagaaagttgtatgagcacaaccgaatgtgaagtt |
41705832 |
T |
|
| Q |
101 |
tgtaagttgaagagtagaaagagaaagtgtatcgcgatagagagaagctattaagcttccatcgccgtaagcgtagtagaatggtggacagtgaaatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705831 |
tgtaagttgaagagtagaaagagaaagtgtatcgcgatagagagaagctattaagcttccatcgccgtaagcgtagtagaatggtggacagtgaaatgaa |
41705732 |
T |
|
| Q |
201 |
ccgcagtctttggtttcaatggagtctaaagggcaatgagccattgtgcatagatcggaagagggggtggaactgtgtgctacagagcatgcatgggagt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705731 |
ccgcagtctttggtttcaatggagtctaaagggcaatgagccattgtgcatagatcggaagagggggtggaactgtgtgctacagagcatgcatgggagt |
41705632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University