View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3620_low_20 (Length: 271)
Name: NF3620_low_20
Description: NF3620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3620_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 128 - 256
Target Start/End: Original strand, 38619659 - 38619795
Alignment:
| Q |
128 |
cctcaagaagtaggataaacgtaaaacctctaacat-----agggggttcatagaggcaagtacgaccaaataggttactatgtaagtgtga---tatta |
219 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
38619659 |
cctcaagaaataagataaacgtaaaacctctaacatgggggggggggttcatagaggcaagtacgaccaaataggttactacgtaagtgtgatattatta |
38619758 |
T |
 |
| Q |
220 |
ccaacctttaaaggaacttcaaaccatgcaacatttg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38619759 |
ccaacctttaaaggaacttcaaaccatgcaacatttg |
38619795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University