View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3620_low_21 (Length: 262)
Name: NF3620_low_21
Description: NF3620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3620_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 21416323 - 21416574
Alignment:
| Q |
1 |
ttttttctagcatgtgaagattgtgatgcgagacattcgagaccgtatgattctgttgttcagatttcgttgagttctgttgcggtgttgtcgtttttgt |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21416323 |
ttttttctagcatgtgaggattgtgatgcgagacattcgagaccgtatgattctgttgttcagatttcgttgagttctgttgcggtgttgtcgtttttgt |
21416422 |
T |
 |
| Q |
101 |
gtttgtccacgtttgtgaagaagtatgggttaaggaggtttttgtttttggataagctttgtgatgaaagtgaaaatgttagaatgaactatatggttca |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21416423 |
gtttgtcgacgtttgtgaagaagtatgggttgagaaggtttttgtttttggataagctttgtgatgaaagtgaaaatgttagaatgaactatatggttca |
21416522 |
T |
 |
| Q |
201 |
gctcaatgtgagttttcttctatctacctcttcagcttgctctgtttctctg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21416523 |
gctcaatgtgagttttcttctatctacctcttcagcttgctctgtttctctg |
21416574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University