View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3620_low_23 (Length: 251)
Name: NF3620_low_23
Description: NF3620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3620_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 11800680 - 11800926
Alignment:
| Q |
1 |
ctcaagtctctttcacctaaaaatcggagagttaagacaaaaatatgccatgactcaaagaaattgataaatgatagaatagaatcaatttaattat--g |
98 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
11800680 |
ctcaaatctctttcacctaaaaatcggagagttaagacaaaaatatgccatgactcaaagaaattgataaatgatagaatagattcaatttaattatatg |
11800779 |
T |
 |
| Q |
99 |
ttaagcatgcaatattgggaaacaaaatcttattcttgatcttatttttagtcttgatttgtgcacccatcttgtgtaggagctattgttttttaaattt |
198 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11800780 |
ttaagaatgcaatattgggaaacaaaatcttattcttgttcttatttttagtcttgatttgtgcacccatcttgtgtaggagctattgtttttaaaattt |
11800879 |
T |
 |
| Q |
199 |
aaaataacaacactaaactaagtgtttggtgcccaatcctatgcttc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11800880 |
aaaataacaacactaaactaagtgtttggtgcccaatcctatgcttc |
11800926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University