View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3620_low_24 (Length: 251)
Name: NF3620_low_24
Description: NF3620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3620_low_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 38619073 - 38619315
Alignment:
| Q |
11 |
cacagaggaagttatgtcatgtccgttgttggtccttttatttcctttattagttcatgtccgtttttccttttcaaaaggaagaatgtgatcttatatt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38619073 |
cacagaggaagttatgtcatgtccgttgttggtccttttatttcctttattagctcatgtccgtttttccttttcaaaaggaagaatgtgatcttatatt |
38619172 |
T |
 |
| Q |
111 |
tctaagaatttttaataacttatttatac--attagattgtgggtttgagaatagattcttacctaaagtaatggatgaagagcttttgaaaaagtctct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38619173 |
tctaagaatttttaataacttatttatacatattagattgtgggtttcagaatagattcttacctaaagtaatggatgaagagcttttgaaaaagtctct |
38619272 |
T |
 |
| Q |
209 |
tcaaaatttatccgtctgaacaaggaaaatatataattttatt |
251 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
38619273 |
tcaaaatttatccgtttgaacaaagaaaatatataattttatt |
38619315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University