View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3620_low_25 (Length: 247)
Name: NF3620_low_25
Description: NF3620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3620_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 4 - 232
Target Start/End: Original strand, 51835929 - 51836152
Alignment:
| Q |
4 |
tgagaaggcaaatgaatcttttggtgaccgatcaatgaaatgttaacgtttttattagcgcttagcatatggtcggagcaaatggaaagattatatccgt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51835929 |
tgagaaggcaaatgaatcttttggtgaccgatcaatgaaaagttaacgtttttattagcgcttagcatatggtcggagcaaatggaaagattatatccgt |
51836028 |
T |
 |
| Q |
104 |
gactcaaagatccctggatttgatgtgcaacaattaagtatgtgacatttgttttcatatagatataaaatgtgaccttatcctctattaattagtttat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51836029 |
gactcaaagatccctggatttgatgtgcaa-----aagtatgtgacatttgttttcatatagatataaaatgtgaccttatcctctattaattaatttat |
51836123 |
T |
 |
| Q |
204 |
ccgttataaatctattcacaattagctat |
232 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51836124 |
ccgttataaatctattcacaattagctat |
51836152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University