View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3620_low_29 (Length: 226)
Name: NF3620_low_29
Description: NF3620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3620_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 207
Target Start/End: Complemental strand, 38533123 - 38532931
Alignment:
| Q |
15 |
cataggttccttgcggtaggaggagatgagtttgttggcttcacgaagctgggttcgataacgaacggtatgggctcgaaggcccggtgcatctttaaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38533123 |
cataggttccttgcggtaggaggagatgagtttgctggcttcacgaagctgggttcgataacgaacggtatgggctcgaaggcccggtgcatctttaaga |
38533024 |
T |
|
| Q |
115 |
acggtttgaacccatttaggatcttcttcaaggaataatgtgttgccacctgggttaaacgaagcccacatgagagaatcatggccaagtccg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38533023 |
acggtttgaacccatttaggatcttcttcaaggaataatgtgttgccacctgggttaaacgaagcccacatgagagaatcatggccaagtccg |
38532931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 98 - 143
Target Start/End: Original strand, 34715422 - 34715467
Alignment:
| Q |
98 |
ccggtgcatctttaagaacggtttgaacccatttaggatcttcttc |
143 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34715422 |
ccggtgcgtctttgagaacggtttgaacccatttaggatcttcttc |
34715467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University