View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3622_high_10 (Length: 412)
Name: NF3622_high_10
Description: NF3622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3622_high_10 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 4e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 36 - 159
Target Start/End: Complemental strand, 32374058 - 32373935
Alignment:
| Q |
36 |
taaactatgttttgaggacatttaaacttcttgaagcttttgtagaaaaaacaacttcttgaagctagttctattattttccttggtggagacgaggatg |
135 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32374058 |
taaactatattttgaggacatttaaacttcttgaagcttttgtaaaaaaaacaacttcttgaagctagttctattattttccttggtggagacgaggatg |
32373959 |
T |
|
| Q |
136 |
atgtgcatatgttaagtggaattt |
159 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
32373958 |
gtgtgcgtatgttaagtggaattt |
32373935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 212 - 250
Target Start/End: Complemental strand, 32373685 - 32373647
Alignment:
| Q |
212 |
gagagagagttcaaagcacttggtgaaaatgtgttgttt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32373685 |
gagagagagttcaaagcacttggtgaaaatgtgctgttt |
32373647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 321 - 412
Target Start/End: Original strand, 12157813 - 12157904
Alignment:
| Q |
321 |
atatcaatatacgtgtgaaaacaaaaatctaatacgatcaaaatatcgacatacctgtctaaactttgtagttccctcgactgcctcagtaa |
412 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||| ||| ||||||||| |||| |
|
|
| T |
12157813 |
atatcaatagacgtgtgaaaacaaaaatctaatacgatcaaaatatcatcatacatgtttaaactttgtagtatccttgactgcctctgtaa |
12157904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 91 - 159
Target Start/End: Complemental strand, 7499557 - 7499489
Alignment:
| Q |
91 |
ttcttgaagctagttctattattttccttggtggagacgaggatgatgtgcatatgttaagtggaattt |
159 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||| | |||||| |||| ||||||||||||||||| |
|
|
| T |
7499557 |
ttcttgaagctagttctattcttttccttggtagaggctaggatggtgtgtgtatgttaagtggaattt |
7499489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University