View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3622_high_12 (Length: 402)
Name: NF3622_high_12
Description: NF3622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3622_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 2e-96; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 3 - 213
Target Start/End: Complemental strand, 1204122 - 1203913
Alignment:
| Q |
3 |
gaggaggagcacagaggatactaagggagagagtgcgtacgtggcggcgtttgattggaggatgttgattcgtgattcggagaaaccgttaataagtacg |
102 |
Q |
| |
|
||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1204122 |
gaggacgagaacggaggatactaagggagagagtgcgtacgtggcggcgtttgattggaggatggagattcgtgattcggagaaaccgttaataagtacg |
1204023 |
T |
 |
| Q |
103 |
gtgattttgttgtgttggatgttttgtgggtcccggtttgttgtgggaccacattggtttgactttgatgatgttgttgtattgatgaataacagaatgg |
202 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1204022 |
gtgattttgttatgttggatg-tttgtgggtcccggtttgttgtgggaccacattggtttgactttgatgatgttgttgtattgatgaataacagaatgg |
1203924 |
T |
 |
| Q |
203 |
tgaggattaag |
213 |
Q |
| |
|
||||||||||| |
|
|
| T |
1203923 |
tgaggattaag |
1203913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 327 - 386
Target Start/End: Complemental strand, 1203802 - 1203743
Alignment:
| Q |
327 |
cattgtcacatggaaatgaatgggtttggtggtgatgcacgttggaagtgattttgaagt |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1203802 |
cattgtcacatggaaatgaatgggtttggtggtgatgcacgttggaagtgattttgaagt |
1203743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 265
Target Start/End: Complemental strand, 1203893 - 1203864
Alignment:
| Q |
236 |
gattcattatggtggtgttgaggttgaaga |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1203893 |
gattcattatggtggtgttgaggttgaaga |
1203864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University