View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3622_high_43 (Length: 236)
Name: NF3622_high_43
Description: NF3622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3622_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 87 - 220
Target Start/End: Complemental strand, 4439305 - 4439172
Alignment:
| Q |
87 |
aggctttcttaactatggcagccgagattaagaacaagtaactaatatttctaacttcccctattctcatttgggatcatatttgttactattttcctgt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4439305 |
aggctttcttaactatggcagccgagattaagaacaagtaactaatatttctagcttcccctattctcatttgggatcatatttgttactattttcctgt |
4439206 |
T |
 |
| Q |
187 |
ttctttgattactttcaaccttattggtattttc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4439205 |
ttctttgattactttcaaccttattggtattttc |
4439172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 87 - 130
Target Start/End: Original strand, 185572 - 185615
Alignment:
| Q |
87 |
aggctttcttaactatggcagccgagattaagaacaagtaacta |
130 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
185572 |
aggctttcttaactatggcagctgagattaagaacaagtaacta |
185615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University