View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3622_high_46 (Length: 227)
Name: NF3622_high_46
Description: NF3622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3622_high_46 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 30238149 - 30238369
Alignment:
| Q |
7 |
atgatagcttccaagacagttttgcaagtgccttggaatgcaactcctattaaaacagtttgtgtgatacagaacaatattatcttcattgtagcaactt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30238149 |
atgatagcttccaagacagttttgcaagtgccttggaatgcaactcctattaaaacagtttgtgtgatacagaacaatattatcttcattgtagcaactt |
30238248 |
T |
 |
| Q |
107 |
ccatcaccaaaagggtcacaattattattatnnnnnnnnnnnnnnnacttgctaatttgtgaagttgttgcactgctgttttggtatcattcagtgattg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30238249 |
ccatcaccaaaagggtcacaattattattatcacacacacaacacaacttgctaatttgtgaagttgttgcactgctgttttggtatcattcagtgattg |
30238348 |
T |
 |
| Q |
207 |
tgctagtgcttttctttcata |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30238349 |
tgctagtgcttttctttcata |
30238369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University