View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3622_low_27 (Length: 287)
Name: NF3622_low_27
Description: NF3622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3622_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 18 - 157
Target Start/End: Complemental strand, 8885742 - 8885603
Alignment:
| Q |
18 |
aaagtgtgatgagataagataataccgcgagaacagtgtcacagaaattgcaatggacataacaaagctggtccgaaggagagagttgttgctgttgttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8885742 |
aaagtgtgatgagataagataataccgcgagaacagtgtcgcagaaattgcaatggacataacaaagctggtccgaaggagagagttgttgctgttgttg |
8885643 |
T |
|
| Q |
118 |
ctggtccggtgaaaaggaagtggatgatgaagaggacatg |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8885642 |
ctggtccggtgaaaaggaagtggatgatgaagaggacatg |
8885603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 234 - 269
Target Start/End: Complemental strand, 8885526 - 8885491
Alignment:
| Q |
234 |
gggattgactgatcagtgaagtttcttgggtgtgtg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8885526 |
gggattgactgatcagtgaagtttcttgggtgtgtg |
8885491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University