View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3622_low_29 (Length: 269)
Name: NF3622_low_29
Description: NF3622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3622_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 54 - 192
Target Start/End: Original strand, 14367796 - 14367934
Alignment:
| Q |
54 |
gaacatccacatcgatcaattgttccctttatgcacatttgatgacaaacaactttgagacaaagcatctgaggaagaaatatatatctcctttttccaa |
153 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| ||| |
|
|
| T |
14367796 |
gaacatccacattgatcaattgttccctttttgcacatttgatgacaaacaactttgagacaaagcaagtgaggaagaactatatatctccttttttcaa |
14367895 |
T |
|
| Q |
154 |
tcaagtttttataatcactttcaatttcactattttctt |
192 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14367896 |
tcaagtttttatgatcactttcaatttcactattttctt |
14367934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 123 - 247
Target Start/End: Complemental strand, 24053098 - 24052974
Alignment:
| Q |
123 |
tgaggaagaaatatatatctcctttttccaatcaagtttttataatcactttcaatttcactattttcttgaaattaacataggatcgatacatctttca |
222 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24053098 |
tgagaaagaaatatatatctccttttttcaatcaagtttttataatcactttcaatttcactattttcttgaaattaacataggattgatacatctttca |
24052999 |
T |
|
| Q |
223 |
ggtattttgatatgatggctgagga |
247 |
Q |
| |
|
|||| |||||| |||||||| |||| |
|
|
| T |
24052998 |
ggtactttgatctgatggctaagga |
24052974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 4 - 72
Target Start/End: Complemental strand, 24053169 - 24053100
Alignment:
| Q |
4 |
cagaacataacaagaaagataacaagagagagaggcgcactacaacaaat---gaacatccacatcgatcaa |
72 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
24053169 |
cagaacataacaagaaagataac--gagagagaggctcactacaacaaataaagaacatccacatcgatcaa |
24053100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University