View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3622_low_36 (Length: 257)
Name: NF3622_low_36
Description: NF3622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3622_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 15 - 233
Target Start/End: Complemental strand, 32318069 - 32317851
Alignment:
| Q |
15 |
attaatcaatgcacatttagaaggcttggatgaaaacacttctttgccatccatactatcatgaagaaaccaattcaaatttgcactatagccataaaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32318069 |
attaatcaatgcacatttagaaggcttggatgaaaacacttctttgccatccatactatcatgaagaaaccaattcaaatttgcactatagccataaaca |
32317970 |
T |
|
| Q |
115 |
gattgttcaaatttccatggctttaaactaacggttgttgattctccggctgatactttgagtcctaaaggatttggtggctcaattgaagcttctatac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32317969 |
gattgttcaaatttccatggctttaaactaacggttgttgattctccggctgatactttgagtcctaaaggatttggtggctcaattgaagcttctatac |
32317870 |
T |
|
| Q |
215 |
ctttgtcaataccaatttc |
233 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32317869 |
ctttgtcaataccaatttc |
32317851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 16 - 181
Target Start/End: Complemental strand, 36042830 - 36042665
Alignment:
| Q |
16 |
ttaatcaatgcacatttagaaggcttggatgaaaacacttctttgccatccatactatcatgaagaaaccaattcaaatttgcactatagccataaacag |
115 |
Q |
| |
|
||||| ||| || |||| |||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
36042830 |
ttaattaattcaaattttgaaggctttgttgaaaacacttctttgccatccatactatcatgaagaaaccaattcaaatttgcactataaccataaaccg |
36042731 |
T |
|
| Q |
116 |
attgttcaaatttccatggctttaaactaacggttgttgattctccggctgatactttgagtccta |
181 |
Q |
| |
|
||| ||| |||||||||||||||||||| | ||||| |||||||| |||||||| |||||||||| |
|
|
| T |
36042730 |
attcttcgaatttccatggctttaaactcatcgttgtggattctccagctgatacgttgagtccta |
36042665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University