View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3623_high_1 (Length: 244)
Name: NF3623_high_1
Description: NF3623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3623_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 6400910 - 6400696
Alignment:
| Q |
19 |
atacatgacatgtagtgcatgtttagttagttagtattttatctt---gaattgttgtctaactaaagaaggnnnnnnnnn------gtgcatgcatgtg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6400910 |
atacatgacatgtagtgcatgtttagttagttcgtattttatcttcttgaattgttgtctaactaaagaaggtttttttttttttttgtgcatgcatgtg |
6400811 |
T |
 |
| Q |
110 |
tagttgaaaggtctaggattttttcgtttcatggctcaccttctaatcnnnnnnnnnagcatatgccatatatgtttgatcccagtcacatgtatgcaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6400810 |
tagttgaaaggtctaggattttttcgtttcatggctcaccttctaatc-ttgtttttagcatatgccatatatgtatgatcccagtcacatgtatgcaat |
6400712 |
T |
 |
| Q |
210 |
actgatatgccttgcc |
225 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6400711 |
actgatatgccttgcc |
6400696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University