View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3623_high_2 (Length: 325)
Name: NF3623_high_2
Description: NF3623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3623_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 4e-41; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 121 - 218
Target Start/End: Complemental strand, 50834410 - 50834313
Alignment:
| Q |
121 |
tgtgttgttacgttagagagagtgaggaaaagagggagtggttgtatgttgtagtggctccgtgaatacttaaaattacaataacaatcagatttcat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
50834410 |
tgtgttgttacgttagagagagtgaggaaaagagggagtggttgtatgttgtagtggcttcgtgaataattaaaattccaataacaatcagatttcat |
50834313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 121 - 218
Target Start/End: Original strand, 50841443 - 50841540
Alignment:
| Q |
121 |
tgtgttgttacgttagagagagtgaggaaaagagggagtggttgtatgttgtagtggctccgtgaatacttaaaattacaataacaatcagatttcat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
50841443 |
tgtgttgttacgttagagagagtgaggaaaagagggagtggttgtatgttgtagtggcttcgtgaataattaaaattccaataacaatcagatttcat |
50841540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 7 - 54
Target Start/End: Complemental strand, 5565217 - 5565170
Alignment:
| Q |
7 |
gagatgaagacgatgatgcttttactttagtggaagaaggctaaaaaa |
54 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
5565217 |
gagattaagactatgatgcttttactttagtgggagaaggctgaaaaa |
5565170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 7 - 92
Target Start/End: Original strand, 43618612 - 43618697
Alignment:
| Q |
7 |
gagatgaagacgatgatgcttttactttagtggaagaaggctaaaaaattaacgaaatgagggaataagaagaagggttttcgtgt |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||| ||||||||||||||||| |||| |
|
|
| T |
43618612 |
gagatgaagacgatgatgcttttactttagtgggagaaggctaaaaaatgaagcaaatgagggcataagaagaagggtttttgtgt |
43618697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 7 - 44
Target Start/End: Complemental strand, 7854283 - 7854246
Alignment:
| Q |
7 |
gagatgaagacgatgatgcttttactttagtggaagaa |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7854283 |
gagatgaagacgatgatgcttttactttagtgggagaa |
7854246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University