View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3624_high_11 (Length: 290)
Name: NF3624_high_11
Description: NF3624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3624_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 3342566 - 3342410
Alignment:
| Q |
1 |
cgacacttaaggtatgccgttgggaaatttaataaacatttgtaacgaaagttaacttttgttcaagaccgagcgacagttaacttccgtggagagtatt |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
3342566 |
cgacacttaagtgatgccgttgggaaatttaataaacatttgtaacggaagttaacttttgttcaagaccgagcgacagttaacttctgtcgagagtatt |
3342467 |
T |
|
| Q |
101 |
tggaatggattacttcggagtggttgagagcaattttaaaagcctaaatagcaattt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342466 |
tggaatggattacttcggagtggttgagagcaattttaaaagcctaaatagcaattt |
3342410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 165 - 281
Target Start/End: Complemental strand, 3341573 - 3341457
Alignment:
| Q |
165 |
gaagataaacggaccgttaatctagcccgtatgacaaacaacttttagaagccagcccatatatccaaatattctaatttattttcaacttttcctcacc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3341573 |
gaagataaacggaccgttaatctagcccgtatgacaaacaacttttagaagccagcccatatatccaaatattctaatttattttcaacttttcctcacc |
3341474 |
T |
|
| Q |
265 |
tcacttcacttctctgc |
281 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3341473 |
tcacttcacttctctgc |
3341457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University