View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3624_low_14 (Length: 244)
Name: NF3624_low_14
Description: NF3624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3624_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 3342638 - 3342866
Alignment:
| Q |
1 |
cataacataaaattagcaaatgtggactccgactcaactgtggcaatcaagttattgcagcattgaacaccatgcttctcaactagttaaaacaatccat |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342638 |
cataacataaaattagcaaatgtagactccgactcaactgtggcaatcaagttattgcagcattgaacaccatgcttctcaactagttaaaacaatccat |
3342737 |
T |
|
| Q |
101 |
tgtctagtttaaagggtactgtgatttggtggcaacgcattctatgggaggctcaatataatttatcagttattgataatctcaaagtttttgaatcagt |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3342738 |
tgtctagtttaaagggtacggtgatttggtggcaacgcattctatgggaggctcaatataatttatcagttattgataatctcaaagttttttaatcagt |
3342837 |
T |
|
| Q |
201 |
tccaaatttgagcataaaaagggtattta |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3342838 |
tccaaatttgagcataaaaagggtattta |
3342866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University