View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3624_low_4 (Length: 381)
Name: NF3624_low_4
Description: NF3624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3624_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 11 - 363
Target Start/End: Complemental strand, 32087188 - 32086840
Alignment:
| Q |
11 |
cagagaaaatcgaacaacatgagacctttattcacaatatgagatccagattagactaaattaactatctgaaccattatccactgagattttaggcgtg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
32087188 |
cagagaaaatcgaacaacatgagacctttattcacaatataagatccagattagactaaattaattatctgaaccattatccactgaaattttaggcgtg |
32087089 |
T |
 |
| Q |
111 |
tatatatgatgatccgccgatcaagttgcaccaggatcattgtagaattgagcctttgcccaatacgaaattattttatgtcctgtttcacatccaacca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32087088 |
tatatatgatgatccgccgatcaagttgcaccaggatcattgtagaattgagcctttgcccaatacgaaattatttta-----tgtttcacatccaacca |
32086994 |
T |
 |
| Q |
211 |
aacaagtaattgacagcacaaaaacaacaaaggagtagttgctgctatccaataatttttggtgttatgtacgtatcattcaga-ttttcttcaccaaat |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32086993 |
aacaagtaattgacagcacaaaaacaacaaaggagtagttgctgctatccaataatttttggtgttatgtacgtatcattcagatttttcttcaccaaat |
32086894 |
T |
 |
| Q |
310 |
cgccaacacgtccatgactcaaatcctcagcaattataactgcattgtggatcc |
363 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32086893 |
tgccaacacgtccatgacccaaatcctcagcaattataactgcattgtggatcc |
32086840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University