View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3625_low_5 (Length: 249)
Name: NF3625_low_5
Description: NF3625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3625_low_5 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 131 - 249
Target Start/End: Original strand, 32146378 - 32146492
Alignment:
| Q |
131 |
tgacttgatggtaatcatttctcttttgatgactttactcatttatttgtattttgtcgtgtagcttaattgatcttgtagatagttactctctccgttt |
230 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||||| || |||||||| |
|
|
| T |
32146378 |
tgacttgatggtagtcatttctcttttgatgacttcactcatttatttgtattttgtcgtgtagcttaattgaacttgcagatagcta----ctccgttt |
32146473 |
T |
 |
| Q |
231 |
ttaaatataaataaatttt |
249 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
32146474 |
ttaaatataagtaaatttt |
32146492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 52
Target Start/End: Original strand, 32146309 - 32146344
Alignment:
| Q |
17 |
aaattcgatgtgaacagctacttcgattctccttcc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32146309 |
aaattcgatgtgaacagctacttcgattctccttcc |
32146344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 217 - 249
Target Start/End: Complemental strand, 36711683 - 36711651
Alignment:
| Q |
217 |
tactctctccgtttttaaatataaataaatttt |
249 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
36711683 |
tactccctccgtttttaaatataaataaatttt |
36711651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 217 - 249
Target Start/End: Complemental strand, 38734976 - 38734944
Alignment:
| Q |
217 |
tactctctccgtttttaaatataaataaatttt |
249 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
38734976 |
tactctatccgtttttaaatataaataaatttt |
38734944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 216 - 248
Target Start/End: Original strand, 2403073 - 2403105
Alignment:
| Q |
216 |
ttactctctccgtttttaaatataaataaattt |
248 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
2403073 |
ttactctctctgtttttaaatataaataaattt |
2403105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 221 - 249
Target Start/End: Complemental strand, 40156231 - 40156203
Alignment:
| Q |
221 |
ctctccgtttttaaatataaataaatttt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40156231 |
ctctccgtttttaaatataaataaatttt |
40156203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 217 - 245
Target Start/End: Original strand, 6006678 - 6006706
Alignment:
| Q |
217 |
tactctctccgtttttaaatataaataaa |
245 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6006678 |
tactctctccgtttttaaatataaataaa |
6006706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University