View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3626_high_19 (Length: 339)
Name: NF3626_high_19
Description: NF3626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3626_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 13 - 211
Target Start/End: Complemental strand, 36548532 - 36548334
Alignment:
| Q |
13 |
aaaatatgcatgttaacagaatattaatgnnnnnnnttatgttcaatatggacaaaatcaagtaaggggatataatggaatagcaaaatggcagcatcat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36548532 |
aaaatatgcatgttaacagaatattaatgaaaaaaattatgttcaatatggacaaaatcaagtaaggggatataatggaatagcaaaatggcagcatcat |
36548433 |
T |
 |
| Q |
113 |
ctttacaaaaactaggtatcaatgtcttctcgggatcaagaaaactatgacattgtttacttcctcctaaaggtagagttatgataatacagttttggt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
36548432 |
ctttacaaaaactaggtatcaatgtcttctcgggatcaagaaaactatgacattgtttacttcctcctaaagctagagttatgatgatacagttttggt |
36548334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 79 - 136
Target Start/End: Complemental strand, 3991336 - 3991279
Alignment:
| Q |
79 |
gggatataatggaatagcaaaatggcagcatcatctttacaaaaactaggtatcaatg |
136 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3991336 |
gggatataatagaatagcaaaatggcagcatcatctttacaaaaactaggtatcaatg |
3991279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University