View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3626_high_25 (Length: 282)
Name: NF3626_high_25
Description: NF3626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3626_high_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 2625320 - 2625128
Alignment:
| Q |
1 |
tagacgataaaaaatctcggaaatcaagaggttggttttgtggatattcttcgcgcaatgcaagaagttcccggaaaaggcagattcggtcccctctatc |
100 |
Q |
| |
|
||||| |||||| ||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625320 |
tagacaataaaacatctcggaaatcagggggtcagttttgtggatattcttcgcgcaatgcaagaagttcccggaaaaggcagattcggtcccctctatc |
2625221 |
T |
|
| Q |
101 |
caactgggcgagtcagtttgtaagagtctctgtccgatattcccacnnnnnnnnnngttaaaatggagtctccgacctgctcatgaaggacatgc |
195 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625220 |
caactgggtgagtcggtttgtaagagtctctgtccgatattcccac--ttttttttgctaaaatggagtctccgacctgctcatgaaggacatgc |
2625128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 198 - 272
Target Start/End: Complemental strand, 2625038 - 2624964
Alignment:
| Q |
198 |
atggtagtgctcatacatggtttggcaaatgtccacctcttatgctcctaatcgtgattttcactataccctatg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2625038 |
atggtagtgctcatacatggtttggcaaatgtgcacctcttacgctcctaaccgtgattttcactataccctatg |
2624964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University