View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3626_high_29 (Length: 256)
Name: NF3626_high_29
Description: NF3626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3626_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 14733218 - 14733431
Alignment:
| Q |
19 |
attgacgtgagaggtaattaaggtcttcttggacctgcagatcccacagtattgacaataatagcgtctaatgtctctgaaaataggtctttcgttactt |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14733218 |
attgatgtgagaggtaattaaggtcttcttggacctgcagatcccacagtattgacaataatagcgtctaatgtctctgaaaataggtctttcgttactt |
14733317 |
T |
|
| Q |
119 |
tcaaatgaatcatccatctctgtatttggcatttcgtgattgcttccgcggtttgcttcgaatttttcagacggcatcctgagtttgttacactgcaccg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
14733318 |
tcaaatgaatcatccatctctgtatttggcatttcgtgattgcttctgcggtttgcttcgaatttctcagacggca---------tgttacactgcaccg |
14733408 |
T |
|
| Q |
219 |
ttaacaaactccactcaaatcca |
241 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
14733409 |
ttaacaaactcaactcaaatcca |
14733431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University