View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3626_high_31 (Length: 249)
Name: NF3626_high_31
Description: NF3626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3626_high_31 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 20 - 249
Target Start/End: Original strand, 46873324 - 46873552
Alignment:
| Q |
20 |
actgttttatattgttcaatcatataaaatannnnnnnnnnnnaattttctagatgctgtgtagaatgtcattttatgtgatatgatgtgcaaattacag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46873324 |
actgttttatattgttcaatcatataaaatatgttttttttt-aattttctagatgctgtgtagaatgtcattttatgtgatatgatgtgcaaattacag |
46873422 |
T |
|
| Q |
120 |
cgattaattaaatgatttgaatgtgtgtcattttgtggttgcgttgtctattatgtttcatgtttgatttgacagagcaagttttgaatggaaaatgatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46873423 |
cgattaattaaatgatttgaatgtgtgtcattttgtggttgcgttgtctattatgtttcatgtttgatttgacagagcaagttttgaatggaaaatgatt |
46873522 |
T |
|
| Q |
220 |
ccatccttgtttataggcagagcaagttct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46873523 |
ccatccttgtttataggcagagcaagttct |
46873552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 204 - 249
Target Start/End: Complemental strand, 48232273 - 48232227
Alignment:
| Q |
204 |
tgaatggaaaatgatt-ccatccttgtttataggcagagcaagttct |
249 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
48232273 |
tgaatggaaaatgatttccatccttgtttataggcagagcaggttct |
48232227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 204 - 249
Target Start/End: Complemental strand, 48237313 - 48237267
Alignment:
| Q |
204 |
tgaatggaaaatgatt-ccatccttgtttataggcagagcaagttct |
249 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
48237313 |
tgaatggaaaatgatttccatccttgtttataggcagagcaggttct |
48237267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University