View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3626_low_24 (Length: 327)
Name: NF3626_low_24
Description: NF3626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3626_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 229
Target Start/End: Original strand, 45208227 - 45208441
Alignment:
| Q |
16 |
caaaattgattttaaaatcaatgacggagattgactacaacgttaaactgcgtgtttctt-acaataaagaatccggatctgaatattaatgggtttctt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45208227 |
caaaattgattttaaaatcaatgacggagattgactacaacattaaactgcgtgtttttttacaataaagaatccggatctgaatattaatgggtttctt |
45208326 |
T |
 |
| Q |
115 |
gatgatatatttttcttattgcaaccaaaatattcgatcaaaatagttcccgttgcaccaaaacttttaattgaaactatgtcccgatattcgacatgtg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45208327 |
gatgatatatttttcttattgcaaccaaaatattcgatcaaaatagttcacgttgcaccaaaacttttaattgaaactatgtcccgatattcgatatgtg |
45208426 |
T |
 |
| Q |
215 |
tcatgtctaataccg |
229 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45208427 |
tcatgtctaataccg |
45208441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 262 - 313
Target Start/End: Original strand, 45208495 - 45208546
Alignment:
| Q |
262 |
tatcggtatcaatgtgtccatgttagtgttatgttcgacgtttgtgtctgtg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45208495 |
tatcggtatcaatgtgtccatgttagtgttgtgttcgacgtttgtgtctgtg |
45208546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University