View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3626_low_33 (Length: 245)
Name: NF3626_low_33
Description: NF3626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3626_low_33 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 3909473 - 3909231
Alignment:
| Q |
1 |
agtagcaaaggccatctaaaacccacaaacaactacgatactctgaatttgaactcaggttaagttgtcaagtataacaatatcaatattatcgattgtt |
100 |
Q |
| |
|
|||| ||||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||| |
|
|
| T |
3909473 |
agtaacaaagaccatctaaaacccacgaacaactatgatactctgaatttgaactcaggttaagttgtcaaatataacaatatcaatattaccaattgtt |
3909374 |
T |
 |
| Q |
101 |
aattacatgtgcaatacaattttgatggaaggttaaaatggtagattggggaaattaagtgataattttgtctttttatgttattgtcatcattattatt |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3909373 |
aatcacatgtgcaatacaattttgatggaaggataaaatggtagattggggaaattaagtgataa--ttgtctttttatgttattgtcatcattattatt |
3909276 |
T |
 |
| Q |
201 |
attacatagggtagaattttaaaactatttacagcaatgagctac |
245 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3909275 |
attacatggggtagaattttaaaactatttacagcaatgagctac |
3909231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University