View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3627_high_5 (Length: 352)
Name: NF3627_high_5
Description: NF3627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3627_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 20 - 345
Target Start/End: Original strand, 46954164 - 46954489
Alignment:
| Q |
20 |
cttgagaggtatcttctaattagttttcttcatctcttccttgcctctttcagttattgttttgaaagtagtttgatcaattcaatactacgattaaatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46954164 |
cttgagaggtatcttctaattagttttcttcatctcttccttgcctctttcagttattgttttgaaagtagtttgatcaattcaatactacgattaaatg |
46954263 |
T |
 |
| Q |
120 |
aaaagtgtataaatgggagtgaatgatgtgtgttgtgagattgccttcttcagaatcttctgttctcaagtccatgccttacttatttgattaatcgtgg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
46954264 |
aaaagtgtataaatgggagtgaatgatgtgtgttgtgagatcgccttcttcagaatcttctgttctcaagtccatgccttacttatttgattaatcatgg |
46954363 |
T |
 |
| Q |
220 |
atatggttgtgccagctatttatgatttgattgattggtgattttcgtaaaaaatttttgcttggtgctccgtatctttttcatatcttgtttgaagcta |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46954364 |
atatggttgtgccagctatttatgatttgattgattggtgattttcttaaaaaaattttgcttggtgctccgtatcttcttcatatcttgtttgaagcta |
46954463 |
T |
 |
| Q |
320 |
atttagttcagtccgaccctatgctt |
345 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46954464 |
atttagttcagtccgaccctatgctt |
46954489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University