View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3627_high_6 (Length: 331)
Name: NF3627_high_6
Description: NF3627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3627_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 3 - 320
Target Start/End: Original strand, 45630982 - 45631302
Alignment:
| Q |
3 |
caccaacatcctcaccagctcccaaggtttcatctccaccttctccaacaccaacctccgctgaagctcccgttgaatctcccaccgagtctccacccgc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45630982 |
caccaacatcctcaccagctcccaaggtttcatctccaccttctccaacaccaacctccgctgaagctcccgttgaatctcccaccgagtctccacccgc |
45631081 |
T |
 |
| Q |
103 |
tcccgtttctcccaccgtctctccagcgacctctcccgttgcttctggacctgctgtcagcgatgctcccgctgaggctcccgctgg---tagcgccgcc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
45631082 |
tcccgtttctcccaccgtctctccagcgacctctcccgttgcttctggacctgctgtcagcgatgctcctgctgaggctcccgctggttctagcgccgcc |
45631181 |
T |
 |
| Q |
200 |
gcttcattcagagtctccttcgttggcggatctgtcgccgctttcgtcgccgctgctttactgatgtagatctggagtatgacgtggcgtttcggtagtt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45631182 |
gcttcattcagagtctccttcgttggcggatctgtcgccgctttcgtcgctgctgctttactgatgtagatctggagtatgacgtggcgtttcggtagtt |
45631281 |
T |
 |
| Q |
300 |
agggttttattatattattat |
320 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45631282 |
agggttttattatattattat |
45631302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 306
Target Start/End: Original strand, 42534827 - 42534873
Alignment:
| Q |
260 |
ctgatgtagatctggagtatgacgtggcgtttcggtagttagggttt |
306 |
Q |
| |
|
|||||||||||||| ||| |||||||| ||||||||||||||||||| |
|
|
| T |
42534827 |
ctgatgtagatctgaagtgtgacgtggagtttcggtagttagggttt |
42534873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University