View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3627_high_7 (Length: 327)
Name: NF3627_high_7
Description: NF3627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3627_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 27694548 - 27694226
Alignment:
| Q |
1 |
tttttgttttaaatagatatgtgattaatacggattacggagttactagatacttatttcttaattcttgtccaaactctaaaaatcttttgtccccaaa |
100 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27694548 |
tttttgttttaaatatatacgtgattaatacggattacggagttactagatacttatttcttaattcttgtccaaactctaaaaatcttttgtccctaaa |
27694449 |
T |
|
| Q |
101 |
ccgtgggcccaggcgggtttaaaaggataaaaaatgagtgatgaggcattattgg-------------ttgacttgaagtcagcaccaagtgagataatt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27694448 |
ccgtgggcccaggcgggtttaaaaggataaaaaatgagtgatgaggcattattgggcggttcatgtggttgacttgaagtcagcaccaagtgagataatt |
27694349 |
T |
|
| Q |
188 |
agtccaggtagctagccatgactgactgactgagtcgagcagatcccccaaccaaccccaaaaaatcaaaatggctatgatgtacggggtactacccatt |
287 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27694348 |
agtccaggtagc----catgactgactgactgagtcgagcagatcccccaaccaaccccaaaaaatcaaaatggctatgatgtacggggtactacccatt |
27694253 |
T |
|
| Q |
288 |
ttcgctgccattttaatattgatctct |
314 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
27694252 |
ttcgctgccattttaatattgatctct |
27694226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University