View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3627_low_4 (Length: 372)
Name: NF3627_low_4
Description: NF3627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3627_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 1e-94; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 180 - 359
Target Start/End: Complemental strand, 18110415 - 18110236
Alignment:
| Q |
180 |
agcactcattcctactatcttttcctctaaattttctttggtaaccaatttctctattgtttttggttctacttcctcttcacccttttgagccttttca |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18110415 |
agcactcattcctactatcttttcctctaaattttctttggtaaccaatttctctattgtttttggttctacttcctcttcacccttttgagccttttca |
18110316 |
T |
|
| Q |
280 |
tttgtttgtgttttggttctctctatagatgttggttttgactccaacacttgttgaccattttgaggcttttcatctat |
359 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18110315 |
tttgtttgtgctttggttctctctatagatgttggttttgactccaacacttgttgaccattttgaggcttttcatctat |
18110236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 18 - 118
Target Start/End: Complemental strand, 18110577 - 18110477
Alignment:
| Q |
18 |
gcagcaagattccttttccttctctggaacatttggagcagaaggttctgctttttcaacttccttttcttctaagttttgattcttgcttgactcataa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18110577 |
gcagcaagattccttttccttctctggaacatttggagcagaaggttctgctttttcaacttccttttcttctaagttttgattcttgcttgactcataa |
18110478 |
T |
|
| Q |
118 |
g |
118 |
Q |
| |
|
| |
|
|
| T |
18110477 |
g |
18110477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 265 - 359
Target Start/End: Complemental strand, 18110255 - 18110161
Alignment:
| Q |
265 |
ttttgagccttttcatttgtttgtgttttggttctctctatagatgttggttttgactccaacacttgttgaccattttgaggcttttcatctat |
359 |
Q |
| |
|
||||||| |||||||| | |||||||||||| ||||||||| ||||||||| ||| || || ||| |||||| ||||||| |||||||||||| |
|
|
| T |
18110255 |
ttttgaggcttttcatctatttgtgttttggctctctctattgatgttggtcttgtttcaaattcttcttgacccttttgagacttttcatctat |
18110161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University