View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3627_low_9 (Length: 251)
Name: NF3627_low_9
Description: NF3627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3627_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 16 - 205
Target Start/End: Complemental strand, 48170667 - 48170479
Alignment:
| Q |
16 |
atcaaaggttttggtgagaaatggaggtggacccatttcatgtaacccttccattggttttggagtaagattagaaccagaagaggaagatgaagatgtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48170667 |
atcaaaggttttggtgagaaatggaggtggacccatttcatgtaacccttccattggttttggagtaagattagaacacgaagaggaagatgaagatgtt |
48170568 |
T |
 |
| Q |
116 |
gaaccaacaacactgacatatgctaatgtttcttcctctttcactctaattcccttcattgatttctaaagaaaggctcgcttgtgataa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48170567 |
gaaccaacaacactgacatatgctaatgtttcttcctctttcactctaattcccttcattgatttctaaagaaa-gctcgcttgtgataa |
48170479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University