View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_high_19 (Length: 344)
Name: NF3628_high_19
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_high_19 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 211 - 344
Target Start/End: Original strand, 10456137 - 10456270
Alignment:
| Q |
211 |
ctatgataaactcaaagctggagaaatgggtcggaagaagtcttttgagaacacctttggctgctgattcttgcacagatggaagtgcccttttggaatc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10456137 |
ctatgataaactcaaagctggagaaatgggtcggaagaagtcttttgagaacacctttggctgctgattcttgcacagatggaagtgcccttttggaatc |
10456236 |
T |
 |
| Q |
311 |
caaccggtgaagcagagattgtatggcttcatga |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10456237 |
caaccggtgaagcagagattgtatggcttcatga |
10456270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 13 - 100
Target Start/End: Original strand, 10455940 - 10456026
Alignment:
| Q |
13 |
tgaacaactttggtcaagtcaacaactaattcaaaagtaacagnnnnnnnnnnnnttgtttttcccttcttactttgtattagagcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10455940 |
tgaacaactttggtcaagtcaacaactaattcaaaagtaacag-aaaaaaaaaaattgtttttcccttcttactttgtattagagcac |
10456026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University