View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_high_21 (Length: 339)
Name: NF3628_high_21
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 19 - 337
Target Start/End: Original strand, 8458287 - 8458611
Alignment:
| Q |
19 |
agatcagtcacatttgtagataatcatgatactggctcaactcaggttcttagttcactatttctcaaaataacacactgaaatacatgctcaagtgggg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8458287 |
agatcagtcacatttgtagataatcatgatactggctcaactcaggtttttagttcactatttctcaaaataacacactgaaatacatgctcaagtgggg |
8458386 |
T |
|
| Q |
119 |
gtgtgtatggtcagcgcaaatttatatgcatttttcttatttcgtatggaaactacaagcctggttatggtataattgatttatgtaaaattaattttgc |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8458387 |
gtgtgtatggtcagcgcaactttatatgcatttttcttatttcgtatggaaactacaagcctggttatggtataattgatttatgtaaaattaattttgc |
8458486 |
T |
|
| Q |
219 |
atttggaaataaattttgctatgtgaattgaaatattaaggaatagaagggatatttaggtttaaaggttactgattaataagg------ttacccactg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
8458487 |
atttggaaataaattttgctatgtgaattgaaatattaaggaatagaagggatatttaggtttaaaggttactgattaataaggtgccttttaaccactg |
8458586 |
T |
|
| Q |
313 |
cgaatatgacatattcttcgacatc |
337 |
Q |
| |
|
|||||||||||| |||||| ||||| |
|
|
| T |
8458587 |
cgaatatgacattttcttctacatc |
8458611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University