View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_high_28 (Length: 296)
Name: NF3628_high_28
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 14 - 280
Target Start/End: Complemental strand, 47564179 - 47563912
Alignment:
| Q |
14 |
aggccgatgtggacggaggctgagccaaacgatgaaggtgatgagcccaatgattgcaagaaggctcaagaaaacagtgcataccatttttgtagcacgg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47564179 |
aggccgatgtggacggaggctgagccaaacgatgaaggtgatgagtccaatgattgcaagaaggctcaagaaaacagtgcataccatttttgtagcacgg |
47564080 |
T |
 |
| Q |
114 |
gttgtgaggctatcttgaacccgttggaggtagtatttggtggaatgatggcgctttatgggcttcggtgttgggtgtggtcccgggcgtgaacctggga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47564079 |
gttgtgaggctatcttgaacccgttggaggtagtatttggtggaatgatggcgctttatgggcttcggtgttgggtgtggtcccgggcgtgaacctggga |
47563980 |
T |
 |
| Q |
214 |
catggtgaacgggtatgtggtcgtttccgtacatttattg-ttttgtttttgtgggtgatattgggag |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47563979 |
catggtgaacgggtatgtggtcgtttccgtacatttattgtttttgtttttgtgggtgatattgggag |
47563912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University