View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_high_34 (Length: 257)
Name: NF3628_high_34
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_high_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 14166563 - 14166334
Alignment:
| Q |
13 |
aaaatattgttactacaatgattt-aactttacattttctgatcatattgtaggtggtgcgagatgcaatcaagaaggttggaaccgatgaggatgcgct |
111 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14166563 |
aaaatattgttactacaatgatttgaactttacattttctgatcaaatcgtaggtggtgcgagatgcaatcaagaaggttggaactgatgaggatgcgct |
14166464 |
T |
|
| Q |
112 |
cacccgtgtgattgtgagcagagctcagcatgacctaaaagtcatctcagatgtttactacaaaagaaacagtgttcttcttgagcatgttgtggccaag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14166463 |
gacccgtgtgattgtgagcagagctcagcatgacctaaaagtcatctcagatgtttactacaaaagaaacagtgttcttcttgagcatgttgtggccaag |
14166364 |
T |
|
| Q |
212 |
gaaacttcaggggattacaagaagtttctt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14166363 |
gaaacttcaggggattacaagaagtttctt |
14166334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 89 - 126
Target Start/End: Original strand, 5189555 - 5189592
Alignment:
| Q |
89 |
gttggaaccgatgaggatgcgctcacccgtgtgattgt |
126 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5189555 |
gttggaaccgatgaggatgcactcacccgtgtgattgt |
5189592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 237
Target Start/End: Original strand, 5181674 - 5181744
Alignment:
| Q |
167 |
tactacaaaagaaacagtgttcttcttgagcatgttgtggccaaggaaacttcaggggattacaagaagtt |
237 |
Q |
| |
|
|||||||| ||||||||||||| |||||| ||| || |||||||||| |||||||| ||||||||||| |
|
|
| T |
5181674 |
tactacaagagaaacagtgttcatcttgaagatgaagtttccaaggaaacctcaggggactacaagaagtt |
5181744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University