View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_high_42 (Length: 240)
Name: NF3628_high_42
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_high_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 33514268 - 33514476
Alignment:
| Q |
18 |
aaaatatactaatatggatatttttctgattggtgtaggtgaggnnnnnnnccataaaaggcagcggagaagaaatataccaaacagagcttgtacaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33514268 |
aaaatatactaatatggatatttttctgattggtgtaggtgaggaaaaaaaccataaaaggcagcggagaagaaatataccaaacagagcttgtacaatt |
33514367 |
T |
 |
| Q |
118 |
attttcggaagaggatgaggtaagcttcataacttcttgtatttacatctttggacttacatcaatatatatatgtgtgtgtgaaatatcctttttacta |
217 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33514368 |
attttcggaagaggatgaggtaggcttcataacttcttgtatttacatttttggacttacatcaatatatatatgtgtgtgtgaaatatcctttttacta |
33514467 |
T |
 |
| Q |
218 |
ttcacaggt |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
33514468 |
ttcacaggt |
33514476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 103 - 151
Target Start/End: Complemental strand, 44064166 - 44064118
Alignment:
| Q |
103 |
agagcttgtacaattattttcggaagaggatgaggtaagcttcataact |
151 |
Q |
| |
|
||||||||| ||||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
44064166 |
agagcttgtgcaatttttttcggaggaggatgaggtaggcttcataact |
44064118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University