View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_high_43 (Length: 240)
Name: NF3628_high_43
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_high_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 55029566 - 55029455
Alignment:
| Q |
1 |
cttcatcaccatttgcatcactattcttcatttataattactattctatacatatataatcactattcttcatcgataatcactattctctaaatttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
55029566 |
cttcatcaccatttgcatcactattcttcatttataatcactattctatacatat----gcactattcttcattgataatcactattctctaaatttttg |
55029471 |
T |
|
| Q |
101 |
cacaatcaatattcta |
116 |
Q |
| |
|
|| ||||| ||||||| |
|
|
| T |
55029470 |
cataatcactattcta |
55029455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University