View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_high_48 (Length: 223)
Name: NF3628_high_48
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_high_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 206
Target Start/End: Original strand, 19056004 - 19056194
Alignment:
| Q |
16 |
acgtaggagaagatgaaaacaatctaatgtatgcttggttgctttttccttgtgtattattgtacgaaatagcactatgaattgttatctgaaagacacg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||| |
|
|
| T |
19056004 |
acgtaggagaagatgaaaacaatctaatgtatgcttggttgctttttccttgtgtattattgtacgaaatagcattatcatttgttatctgaaagacacg |
19056103 |
T |
 |
| Q |
116 |
acacatctggataagatgaagagcatgttccatgtgcattagtgcatgatgcatgtggttcccctccagcaacactagttatgttaatatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19056104 |
acacatctggataagatgaagagcatgtcccatgtgcattagtgcatgatgcatgtggttcccctccagcaacactagttatgttaatatg |
19056194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University