View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_high_6 (Length: 444)
Name: NF3628_high_6
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 19 - 434
Target Start/End: Original strand, 8458287 - 8458708
Alignment:
| Q |
19 |
agatcagtcacatttgtagataatcatgatactggctcaactcaggttcttagttcactatttctcaaaataacacactgaaatacatgctcaagtgggg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8458287 |
agatcagtcacatttgtagataatcatgatactggctcaactcaggtttttagttcactatttctcaaaataacacactgaaatacatgctcaagtgggg |
8458386 |
T |
 |
| Q |
119 |
gtgtgtatggtcagcgcaaatttatatgcatttttcttatttcgtatggaaactacaagcctggttatggtataattgatttatgtaaaattaattttgc |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8458387 |
gtgtgtatggtcagcgcaactttatatgcatttttcttatttcgtatggaaactacaagcctggttatggtataattgatttatgtaaaattaattttgc |
8458486 |
T |
 |
| Q |
219 |
atttggaaataaattttgctatgtgaattgaaatattaaggaatagaagggatatttaggtttaaaggttactgattaataagg------ttacccactg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
8458487 |
atttggaaataaattttgctatgtgaattgaaatattaaggaatagaagggatatttaggtttaaaggttactgattaataaggtgccttttaaccactg |
8458586 |
T |
 |
| Q |
313 |
cgaatatgacattttcttctacatcattttacttataccttcnnnnnnnnnnnnnnnnnnggcaataacacattgcattttccgattaaaatcctaaact |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8458587 |
cgaatatgacattttcttctacatcattttacttataccttctttttttataatttttttggcaataacacattgcattttccgattaaaatcctaaact |
8458686 |
T |
 |
| Q |
413 |
catgctcttgattcactctctg |
434 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8458687 |
catgctcttgattcactctctg |
8458708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University