View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_low_15 (Length: 367)
Name: NF3628_low_15
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 22 - 350
Target Start/End: Original strand, 33185943 - 33186264
Alignment:
| Q |
22 |
tctcttattttcactatctccatccaccaagaagaacaaccccattttatcattatatgatattaagttgagtattgtgtgtttgcttgcatattcacat |
121 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33185943 |
tctcttattctcactatctccatccaccaagaagaacaaccccattttatcattatatgatattaagttgagtattgtgtgtttgcttgcatattcacat |
33186042 |
T |
 |
| Q |
122 |
aataagttggacatggatttggcatagtatcacagtaaacagacacatggatctcaattcttcgataaagatcaaacaatctgaattttaaaacacatta |
221 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
33186043 |
aataagttggacatggatttggtatagtatcgcagtaaacagacacatggatctcaattcttcgataaagatcaaacaatctgaattttaaaatatatta |
33186142 |
T |
 |
| Q |
222 |
tatattttaaatatcatactttaattatgaatcgttcgatcttaatcgaactctcgagacgtgtgtgactgctgcagcctgcaactagctaactataatt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
33186143 |
tatattttaaatatcatactttaattatgaatcgtttgatcttaatcgaactctcgagacgcgtgtgactg-------ctgcaactagctaactataatt |
33186235 |
T |
 |
| Q |
322 |
gatagcaactttatattcttttttattat |
350 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33186236 |
gatagcaactttatattcttttttattat |
33186264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University