View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_low_17 (Length: 362)
Name: NF3628_low_17
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 69 - 145
Target Start/End: Complemental strand, 9479834 - 9479758
Alignment:
| Q |
69 |
aacgtgattatcttaatgattaatttttataagattatatcacatataaaataaaaacattaatcaatcacatcttt |
145 |
Q |
| |
|
|||||||||||||||||||||||| ||| | |||||||||| ||| ||||||| || ||||||| ||||||||||| |
|
|
| T |
9479834 |
aacgtgattatcttaatgattaatatttgtgagattatatcttataaaaaataataagattaatccatcacatcttt |
9479758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 9479867 - 9479823
Alignment:
| Q |
1 |
tttaactaatacctagatccatgcatgcactagaacgtgattatc |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9479867 |
tttaactaatacctagatccatgcatgcactaaaacgtgattatc |
9479823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University