View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_low_18 (Length: 360)
Name: NF3628_low_18
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 322; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 12 - 341
Target Start/End: Original strand, 44221048 - 44221377
Alignment:
| Q |
12 |
ttggacaccaccaaaaaactacgtgtctccctatatcttccttgtgattacattattccttacaaaaatatgtataatacctgcactgtgagctttccac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44221048 |
ttggacaccaccaaaaaactacgtgtctccctatatcttccttgtgattacattattccttataaaaatatgtataatacctgcactgtgagctttccac |
44221147 |
T |
|
| Q |
112 |
atatttcatgccataatttgaagtttcatcgagctcaagatttgaacatttcatacttctgagtcaattgcaagctgttctgttaagttttagttacagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44221148 |
atatttcatgccataatttgaagtttcatcgagctcgagatttgaacatttcatacttctgagtcaattgcaagctgttctgttaagttttagttacagg |
44221247 |
T |
|
| Q |
212 |
aaatgctttaccttttagaactagtatcatagagagtttggaaaaacgcttttatcataagggtatgttggattatagtttgaaaaaccatgttaagttg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44221248 |
aaatgctttaccttttagaactagtatcatagagagtttggaaaaacgcttttatcataagggtatgttggattatagtttgaaaaaccatgttaagttg |
44221347 |
T |
|
| Q |
312 |
ggtttttgacacttccataagttgtcaatg |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44221348 |
ggtttttgacacttccataagttgtcaatg |
44221377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 213 - 250
Target Start/End: Original strand, 44221374 - 44221412
Alignment:
| Q |
213 |
aatgctttaccttttagaactag-tatcatagagagttt |
250 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44221374 |
aatgctttaccttttagaactagttatcatagagagttt |
44221412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University