View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_low_25 (Length: 305)
Name: NF3628_low_25
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 19 - 304
Target Start/End: Complemental strand, 43224964 - 43224679
Alignment:
| Q |
19 |
ggtgttaaggatactttatctgtagatggtttggtatttaaaaatgattcttggttgtgtctgtaggtccttgacatgtgccgtatttattgggtttgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43224964 |
ggtgttaaggatactttatctgtagatggtttagtacttaaaaatgattcttggttgtgtctgtaggtccttgacatgtgccgtatttattgggtttgct |
43224865 |
T |
|
| Q |
119 |
cgggcttattgcagaatttggacgatatgtattacatgttaaggtcatcttcacaagtcaatctccggatcatgaaaggatgacttccgaggacagtaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43224864 |
cgggcttattgcagaatttggacgatatgtattacatgttaaggtcatcttcacaagtcaatctccggatcatgaaaggatgacttctgaggacagtaat |
43224765 |
T |
|
| Q |
219 |
gctcaacatttcagaattcatcagcagatgcaacatctttctagtggcaaatctgatggaggcattttatgttcatcacctggtct |
304 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||| || ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43224764 |
gctcgacatttcagaattcatcagcagatgcaaaatctttctagtagctaatttgatggaggcattttatgttcatcacctggtct |
43224679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University