View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_low_37 (Length: 251)
Name: NF3628_low_37
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_low_37 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 39 - 251
Target Start/End: Complemental strand, 55029952 - 55029737
Alignment:
| Q |
39 |
ttggaggtggagatgttcttcttgctggcataggcaaggcaaggaggatgcaagttccaaatgtgaatatgcaacattgtgttggtacgaatctcattca |
138 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||| ||| |
|
|
| T |
55029952 |
ttggaggtggagatgttcttcttgcaggcattggcaaggcaaggaggatgcaagttccaaatgtgaatatgcagcattatgttggtactaatctcactca |
55029853 |
T |
 |
| Q |
139 |
tttggcttatttgaacgctaatctaaaaaattccctttttgttatatgtttgactgttttgcttcaaattttaccttccccaacgtagatctcaacat-- |
236 |
Q |
| |
|
||||||||||| |||| | |||||||||||| |||||||||| ||||||||| ||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55029852 |
tttggcttattcgaacacaaatctaaaaaatcccctttttgtggtatgtttgattgttttgtttcaaattttaccttccccaatttagatctcaacatca |
55029753 |
T |
 |
| Q |
237 |
-atgaatcatttttat |
251 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
55029752 |
aatgaatcatttttat |
55029737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 47 - 152
Target Start/End: Original strand, 50338195 - 50338300
Alignment:
| Q |
47 |
ggagatgttcttcttgctggcataggcaaggcaaggaggatgcaagttccaaatgtgaatatgcaacattgtgttggtacgaatctcattcatttggctt |
146 |
Q |
| |
|
|||||||||| || ||| |||||||||| ||| ||||||||||||||||||||||| |||||||| ||| ||||| |||| ||||||| ||||||||||| |
|
|
| T |
50338195 |
ggagatgttcctcatgcaggcataggcagggcgaggaggatgcaagttccaaatgttaatatgcagcatagtgttagtactaatctcagtcatttggctt |
50338294 |
T |
 |
| Q |
147 |
atttga |
152 |
Q |
| |
|
| |||| |
|
|
| T |
50338295 |
aattga |
50338300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University