View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_low_40 (Length: 250)
Name: NF3628_low_40
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 47564529 - 47564762
Alignment:
| Q |
1 |
catgggaaagccagcgccacaggatgcacgcaacctgtgatgcgggtgtgggatctaatggtaccctcttatctatttacaaagataagaggtgcacggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47564529 |
catgggaaagccagcgccacaggatgcacgcaacctgtgatgcgggtgtgggatctaatggcaccctcttatctatttacaaagataagaggtgcacggt |
47564628 |
T |
 |
| Q |
101 |
tgacttcgcttaaggggactgttgtgtgtttccaatgtcacacacaaaagagcttgaaatttcactaatttgtctttgtaattgattaatttccttttct |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47564629 |
tgacttcgcttaaggagactgttgtgtgtttcc-atgtcacacacaaaagagcttgaaatttcactaatttgtctttgtaattgattaatttccttttct |
47564727 |
T |
 |
| Q |
201 |
ttatctatcgaaacttttttccttaccagccaact |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
47564728 |
ttatctatcgaaacttttttccttaccatccaact |
47564762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University