View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_low_41 (Length: 250)
Name: NF3628_low_41
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_low_41 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 4764534 - 4764773
Alignment:
| Q |
10 |
aataatattggtaaactggggagtgggaaaacctaacatattcaaaatgccactcaaacacttctagataaaaggacgattaagaaataaatgatttgaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4764534 |
aataatattggtaaactggggagtgggaaaacctaacatattcaaaatgccactcaaacacttctagataaaaggacgattaagaaataaatgatttgaa |
4764633 |
T |
 |
| Q |
110 |
ttttatnnnnnnnnttatatgactggnnnnnnntccgccgctcctagggttagtgtcgccgctcccttgtgagggattctgctgtggtttggtgagatat |
209 |
Q |
| |
|
|||||| |||||| ||||| ||||||||||||||||||| |||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4764634 |
ttttat-aaaaaaattatatcactggaaaaaaagccgccgctcctagggttagcgtcgccactcccttgtgagggattctgttgtggtttggtgagatat |
4764732 |
T |
 |
| Q |
210 |
ctgctcctcttaacgttttttgtttccacttcatagagata |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4764733 |
ctgctcctcttaacgttttttgtttccacttcatagagata |
4764773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 101
Target Start/End: Original strand, 4670407 - 4670441
Alignment:
| Q |
67 |
acacttctagataaaaggacgattaagaaataaat |
101 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
4670407 |
acacttctagataaaaggacaattaagaaataaat |
4670441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 144 - 228
Target Start/End: Complemental strand, 19061338 - 19061253
Alignment:
| Q |
144 |
ccgccgctcctagggttagtgtcgccgct-cccttgtgagggattctgctgtggtttggtgagatatctgctcctcttaacgtttt |
228 |
Q |
| |
|
||||||||||||||||| || ||||||| ||||||||||||||| ||| || ||| | |||||| ||| |||| || |||||||| |
|
|
| T |
19061338 |
ccgccgctcctagggttcttgccgccgctacccttgtgagggattttgccgtcgttcgttgagatttcttctcccctgaacgtttt |
19061253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University